EST 39193 is a singleton


Sequence

>39193 (1 EST) Length=326 ATGCCGGCGAGCAACAGCGTGACAGCGTCGACAGCTTCAATGCCTGTNCGACCGCNATCGAAGCATCACGAGCCCGAACA GCGCCACGAACGANTGCTCGTNGCGCATCGTCGAGGTCATGTGGCGGAACAGGTAGTTGCACGAACGCGCGACCAGATAC GCGACGATGAACGAACCGACGATCAGGTACAGCGGCTGCAGGTTCGTGGCGAACACGTTGCCGTACGNTTCCTGATGAAG CCAGCTCGTCACGAGCTTGGTCAGCACGATCGCATACACGCTGTTGAGCGCGGTCAGCGTGATGAGGCGTTGCGACACCT GCCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39193: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39193514587T14420SMEST0081Schistosoma mansoni, adult worm, Gloria Franco


Date: 19:15:16 on Fri 24 Nov 117.