EST 39195 is a singleton


Sequence

>39195 (1 EST) Length=290 ACGAGGCAGATCTTGGAGGGCCCAGATTGCAGCCCAATTTAGTGGTTGCGCATTAAAAATTGTCAATTTCATTCCTGGTG TGACTGATAAGGATAAAAAGTTCTTGGAAAAGTTCCCTCCTGCAACTGTCCCGGTTTTTGAAGCTGATGATGGTACATGC CTTTCCGATGTGAATGCCATAGCCTGTTGTTTGGGAACCGNTCAGCTGAGAGGCGGTAAAAATACACACTTCGTCACACA GTGGGTCAATTATGCAGATAACAACATCCTGCCGTCTGTCGCTACCTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39195: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39195514589T14422SMEST0083Schistosoma mansoni, adult worm, Gloria Franco


Date: 6:15:49 on Sun 19 Nov 117.