EST 39205 is a singleton


Sequence

>39205 (1 EST) Length=262 CTGGCGCGTTACCCCGGCTTGTCGGTGGCGGTCGATTTCGACGACCGGATCGTNGATGTCGTGCGCGCGGCTACGACATC GTCATCCGTGGCGGCAACANTCGCGATTCGGCGCTGGTGTCGCGACCGATCTTTCGCATGCATGCGGTGCTGGTAGCGTC ACCGGCCTATCTNGCCCGNCACGGGGTTCCGAGAACGNCGGACGAACTCGGNGCGCACCGCCTTANTGCCCGTCGCTTTC TCGACGGCGAGGTCGCGACGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39205514599T14432SMEST0093Schistosoma mansoni, adult worm, Gloria Franco


Date: 16:50:10 on Wed 22 Nov 117.