EST 39209 is a singleton


Sequence

>39209 (1 EST) Length=281 AGGCCGACGCGATGCAATCCAGCACGAACATCCCGCCGACCGNATGCACGGCATCGNCCACTGCGCGCAGGTACCCGTCG GGCAGCATCATCCCGGACGCCGTTTCGACGTGCGGCGCAAACACCAGATCGGGCTTNTTCTCCTTGATCGNGGCGACCAC TTCCTCGATCGGCGCCGGCGCGTAGGCAGCCTGCCGGCCCGCTTCGACCGGACGCGCCTTCAGCACCGTCGTTTCGGACG GAATGCTGCCCATGTCGAAAATCTGCGACCAGCGGAAGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39209: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39209514603T14436SMEST0097Schistosoma mansoni, adult worm, Gloria Franco


Date: 18:52:28 on Wed 17 Jan 118.