EST 39215 is a singleton


Sequence

>39215 (1 EST) Length=338 CCTTTGGTCGCGCCCTCTTATATCTGAGGGAAAAGTTATCCGTAAATCATCGAAAATTCAGGACTCATGGGACTTGGATT CATGTGATGAAGACGAAGGTCTGGTGTTCGCTCTGAAGAACTTTACTTCTCAACATGAAGCCCAAATTAGTAGAGAGTTG GATTTAAAGTCATGGAAATCACTAAGTTACTCTGGGCACACTTGTGAGCTGTATCTTGTCTCACGTTTGGCACCCAACTT TGCTACCGTTTGCCGCGTCTTGTACGAAATTCGTAAACGATGCCCAAGTTTCATTCCAAAGTCATTATTTGATTTTGGCT CTGGGCTCGGAACAGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39215: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39215514609T14442SMEST0103Schistosoma mansoni, adult worm, Gloria Franco


Date: 16:18:10 on Mon 20 Nov 117.