EST 39228 is a singleton


Sequence

>39228 (1 EST) Length=337 AATTACACCTTCCAAGCCTAGTGCTACTCCGGAATCAAAGAACAAGCATCCCGTCAACGGTAAAGTCACTCCAGTAAGAG GTGGATCCAAGCNTCCAGTCCCTGTCGGCAGCGACGAGAGTNATGTGGACGTTGAGTTGGGTGTNTTGGGCGGCGATGCT GGTGAATCAAGGATGTCACATAAGAAATTGAAGCTGGCGACTGAGAAGGAGATGGAATTAAAGAAAAAGGGTCTCGGCAG TNAAGATNAAGAGGAGGAGAACGNCGACGAAGAAAATNACGATGAAGAAGAGGAGGACGACATCGNCGACGNNGAGAATA GAGATGATGATNAGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39228: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39228514622T14455SMEST0116Schistosoma mansoni, adult worm, Gloria Franco


Date: 16:14:45 on Mon 20 Nov 117.