EST 39244 is a singleton


Sequence

>39244 (1 EST) Length=396 TCAACATCATCATCGAGATCGCAGACGTCATCCAGATTATTAAACAACAACTTGGAATATCAGCTAGTACCAATTACTGA ACGTACATTAAATATACCTGAAAGACATAGTGACGAACATTTAGCAAATTATGAAATTGTGTTTAATGTCAAATTATTAT CCCCCATTGGATTTAGTTTATTCTATTTAGCTCTTAATAAAACGNCTTATCAAAATCAAGATGTATATAATCATTATGAN CCATTACAAACAGACACTTCTTCCATGTCATCTTCATCATCATCATCATCGATTCCAACAGTATCGTCAGTTCATTCCCC TGTTGATATCGATCAGTTATCGTCTAAAACAATTGAATTCAATGCTCATTTCATTGAAGGTTCTCACAATCCATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 39244: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39244514638T14471SMEST0132Schistosoma mansoni, adult worm, Gloria Franco


Date: 19:30:50 on Mon 20 Nov 117.