EST 39251 is a singleton


Sequence

>39251 (1 EST) Length=348 GGAGTNGATTTATTTATTTTTTCCTTGCATTTTGTACAAGTNGCAAAACGAAAAAAGTGAAACTGTAGCTACCTTATTCG TGAAAAGGTAAATAAAAAAGAGGTTTGACATAAAANTTAGTGGCATTTTACATATGTATCAAGGATTAACGTTTACTTCA ATATTTGAGAAATGAGATCAAATACAGACTGATTTTTCATCAAGTCACGTTCAGCATTCTCAATTAGTATTTGCCATAAT CGTCCCACAGTTACTTTTTCAGANGAAAGCAACGTATACATTGCATAAATNCTATCACAAAACTCTTTATCACCAAAAGT AAAATATGCCAGTGACTTTTTAGCTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39251: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39251514645T14478SMEST0139Schistosoma mansoni, adult worm, Gloria Franco


Date: 15:9:32 on Fri 24 Nov 117.