EST 39258 is a singleton


Sequence

>39258 (1 EST) Length=301 TGAATGTAGAGCTCGAAGCGCTCGGTNGACCTCGGGGCGCTCGTCGTTGGCGCGCGCCAGGCGNAGNATCTCGGTCGGGT GCTCCATGATGAAGGTCGGCTGCCAGAGCTTCTCTTCGACGGTCTCCTCGAAGTACATCACCTGCAGGCTGGCCAGACTG CGCTGCGAGAGCTTGTCCTTCTCCTCGCTCAGGCCGATCTTGCGCAGCGTTGACGAGCCAGGCGCTGTCGTCGACGNCGT CGNCCGCATCGGTGTGCTTAAGGATCGCTCGGGATCGTCAGGCGCTCGAAGGGCTGCGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39258: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39258514652T14485SMEST0146Schistosoma mansoni, adult worm, Gloria Franco


Date: 23:25:9 on Sun 19 Nov 117.