EST 39266 is a singleton


Sequence

>39266 (1 EST) Length=322 AGGGGATCAGAAAGGNCTGCAGGGCAAGCAAGGTGACCCTGGTATACCAGGTGACCGTGGTCCGAAAGGTAGCAAAGGAA CTTATGGTCCAGTCGGTCCTTTGGGGCCTCCTGGACCAAAGGGTGAACAAGGTGTTCCTGGACTTGAGGGCGCACGAGGT GTGGTCGGCCTTAAAGGAGAAAGGGGTCCTGTCGGACCTGCTGGAGACCCAGGGCAACCAGGTCCATCTGGACCAATCGG TCCTGAAGGTCCAGCTGGACATCCTGGTCCACCAGGATTACCTGGTGTTCCAGGTCAAAAGGGTTCATCTGGTCCAGCAG GA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39266: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39266514660T14493SMEST0154Schistosoma mansoni, adult worm, Gloria Franco


Date: 4:46:0 on Sat 25 Nov 117.