EST 39273 is a singleton


Sequence

>39273 (1 EST) Length=229 AGTAAAAACTGAAAGTTTATATTTNACAAATATTGTAGGTTACAGACGGCAAACACTGGAGAAGTCATCAAATATCAGTA ATGATCTGCAAGAAGTTCACAAATAACATACAGCTGATAACAAATTAACATACGCTGAAACCTTAGTTGCAATAATCAAT AAAANCAACTACTTTNTTGCAATGACAACTCTAATGAGCCCTGATTTAAAAATGGCCAAAAATGATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 39273: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39273514667T14500SMEST0161Schistosoma mansoni, adult worm, Gloria Franco


Date: 9:3:24 on Sat 18 Nov 117.