EST 39278 is a singleton


Sequence

>39278 (1 EST) Length=150 TTTCCGTATGAGGGTTTAAGCAGACAACGGTTGGTTGTCCCATTCCTGAGAAAATCTGACAAGTTAAGCGAAAGTNCATG GGGAGATGTATTGGTTAAAATAGCGGAAAATTTNCTNCCTATACTTGGTTCANCAGANGAAAGTATACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39278: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39278514672T14505SMEST0166Schistosoma mansoni, adult worm, Gloria Franco


Date: 8:55:32 on Mon 20 Nov 117.