EST 39280 is a singleton


Sequence

>39280 (1 EST) Length=231 ACCTCCAATCGGTCCAGGTTCAGTAACATCTGGNACAACCCCAGCTGGAGAAACCCCGGCAACAGTTTCANCTCCTGGNG ACAACTCTAACTCCACAACAGCGGATCGTACCAGCAATACTACAGCCAACCCACCTAATCAAGCTGAATTNACCTCACTA TTATCCAGTATGCTAAATATGATGTCTACCACTAATAATGGATTGGNTGCCACAAACAATGCTCCACCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39280: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39280514674T14507SMEST0168Schistosoma mansoni, adult worm, Gloria Franco


Date: 3:59:15 on Thu 23 Nov 117.