EST 39281 is a singleton


Sequence

>39281 (1 EST) Length=251 GTGAAAATAGATATATAANTCCAGACAAGGCGAGTAAAAATAGGATTTACCCGCCATCACATACTCTGCATTATTGGAAT TNTCCTCCGANTTATACCCCAGAGGAACTGCGCAAGTNGATTGTNGANTGTGGTGCTTCACCACCCTCGCCAAATTGCAC CTTTCCCAAGGNTTAGTGATAGGTCCTCTTCGGGCCTTGTAGAATGGGGAACAAAAGATGAAGCCGTTACTGCCCTTGCT TTGTGCAACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39281: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39281514675T14508SMEST0169Schistosoma mansoni, adult worm, Gloria Franco


Date: 13:41:44 on Thu 23 Nov 117.