EST 39289 is a singleton


Sequence

>39289 (1 EST) Length=180 CACACACTTCTNTAACTGGGCGTGTTAGGATAGTCAATAAACTCGTATATGTAGAGCCACCGAAGCTCGGTACTTTGGCA ATGTTGGAGATACTGTAGTGGNCCGCATTGTAGAGGTTGANCAACGTCGCTGGCGTGTTGATGTCAACTCTNCTCTNCTA GCCAATCTAGCCTTGGCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39289: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39289514683T14516SMEST0177Schistosoma mansoni, adult worm, Gloria Franco


Date: 10:34:13 on Sat 18 Nov 117.