EST 39290 is a singleton


Sequence

>39290 (1 EST) Length=253 ATCATTTATAACATTTATTTTTTTAGAAATTCCACAAGACAATGAAATTTAGAAAGGTAGAATTAAAAAGAAAATAAATA TTATTAATACTATCAATTCACATCGAAACTCCTTTCATTTTACATTACGNAACTTAATCAAGAAGATAGATTTCAATGAN TACAATGGAACAAAATATGTTTCTGTGTTGATAGGTGATTATCTAAGTNATTGATTAATTAACCTNGTTTTGAATTTCTT TGTTTACACAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39290: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39290514684T14517SMEST0178Schistosoma mansoni, adult worm, Gloria Franco


Date: 23:21:27 on Fri 17 Nov 117.