EST 39291 is a singleton


Sequence

>39291 (1 EST) Length=251 CAACAGATCTATGAGCATGGTCGGTGTGAACAGATTAAATGATAGTGAACATATTATAANCAGCAGTATTCATGTACCAC GATACGATCATACAATGGAAATTNCCAAACTGAAAACTAAATCGTATCGTCATTCTAAGGTGATGGAACAAACAATTAAC CCTGAACAATCACCTTGTGAAAAACATCACTNTACGTNATCATCTCANTCAAGNCAAACACATAATANTGGTAAATATGT CAAATCACAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39291: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39291514685T14518SMEST0179Schistosoma mansoni, adult worm, Gloria Franco


Date: 13:0:54 on Sun 19 Nov 117.