EST 39316 is a singleton


Sequence

>39316 (1 EST) Length=260 GATTCAAAAGCACATATAATACAAACTTGAGANTGAGTAGCAGGGNTTAACAAAAGANTAAAGAGCCACTGTAAATTAGA TCAAAANTAAATACCTAATCTACACAACANGATAGTAAANTTNGATTTTNTTTTCATACAATACAAACGTGAAATTGTTT TCGAAAAAGGAAGTGTCAAAANTACACACATATACATCACACAAAGCGTTGTTGTCGAGATCTCTCTTATTCACCTTTTT CTTTGTCATCTTTTAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39316: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39316514710T14543SMEST0204Schistosoma mansoni, adult worm, Gloria Franco


Date: 22:55:3 on Wed 22 Nov 117.