EST 39341 is a singleton


Sequence

>39341 (1 EST) Length=413 GTGCCTATGTTTCTTACTAGGACAGAGTATGATCGTGGAGTTAATACGTTTTCCCCCGAGGGACGACTCTTCCAAGTAGA ATACGCCATAGAAGCTACAAAGCTGGGTTCAACGGGAATCGGGATCAAGACAAGTGAGGGTGTTGTTATGGCTGTAGAAA AACGGGTAAACTCAACTTTAATCATACCATCCAGCATTGAAAAGATTTTTGAGGTGGATAAGCACATAGCATGTGCTGTT AGTGGTCTTGTTGCTGATGCAAGANCCCTCATAGAACGTGCACGTACAGAAGCAGCTCATCATTGGTTTGTGTACAATGA AAAAATGACTATTGAGGATGTGACTAAAGCTGTGAGTAACTTGGCTCTAGCATTTGGTGATGATGACATGGAGTCTGGTG CAATGAGTCGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39341: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39341514735T14568SMEST0229Schistosoma mansoni, adult worm, Gloria Franco


Date: 7:1:38 on Tue 21 Nov 117.