EST 39345 is a singleton


Sequence

>39345 (1 EST) Length=297 TNTTTGATAACAGNATAATANGGNAAATTGAAGCCCAATGTGAGTGANGGTCCACAAAATTGTTTTGGTAAAGACGAGGT TTCAAAACCGATTTTCCATACCAGACATACAATCTAGGATTTACAGGCATCATTATCATGTGAACACACAAAACTGATGT CAAGTTCAGAAACTGAAAAGGTCATTCAGGNACGCAAAACTGCTGANTTGGGATGCAGGGCTGGCGGCATAATATGAGAC TCAATATCAGTAAAATGGTTGGGNGATTTAGANGCTTCTGAGTTTTCCGAATCCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39345: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39345514739T14572SMEST0233Schistosoma mansoni, adult worm, Gloria Franco


Date: 23:49:48 on Fri 17 Nov 117.