EST 39346 is a singleton


Sequence

>39346 (1 EST) Length=406 CAATACCGCACACGNTGTTGATGAAAACAAGAAAATCGCCCTTAGATTGCTCACTTTATTGGGGGATTCTCGTGATCTTA TCCTAGTTAAAAACCAATTGAATTCGTCGGATTCCAATCGAATAACAACCGAAGTTCTTGCCGTTGCTGTTTTACATTTA TGTGAAGAAGGTACCAATCTTAAGTTGGCGGAGGCGGAACCATGTGAATTAGCTGCAATATTAGTAGCATGTGCTGAAAA CTTTTTGCATCGCGATGCGTTTACGTCATCCCTTACATCTAAGGATAATCGCAAAATGNAACCCACAAAATTNTCATGTC ATCCTCTATCTCTCGTATGGTCAAACCTCCTTAGCAAAACTTTATGTGTGACACAGTTAANCTTATTNCCAAGTCCAAAC TAGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39346: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39346514740T14573SMEST0234Schistosoma mansoni, adult worm, Gloria Franco


Date: 13:15:35 on Wed 22 Nov 117.