EST 39347 is a singleton


Sequence

>39347 (1 EST) Length=375 GACCAATACAGACAAAGTTTATTTGATTGAAAANGCATAGAAATATTGTCAAGTATATCTACCCATGTNATCTAATGTAC ATAAANGTTATCACAATTCAATTTTGTNGATCACTCTTGACTAACTGCNGGAATAGTATTCATATTGCAAATATTTGGTT CCGTTCGAGTTGTGTCTATTTGCTCTATAAAATCATCCAACTCACATGTATACTCACGATCTAAACTCCAAAACTTCCTT ACCTCATCAATATATGCTTTAGCATCCCAAGTACAATTGATGACGAATTTNATCATCTGAGTGAAATCCACTACTACCCA TTGACAGATTGAGATTGGTTGGGAAATTTGTGGAACTACCACGCCTAACTTCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39347: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39347514741T14574SMEST0235Schistosoma mansoni, adult worm, Gloria Franco


Date: 12:40:8 on Fri 17 Nov 117.