EST 39368 is a singleton


Sequence

>39368 (1 EST) Length=162 TCATNACTACNTCGTGGGTTACACAGTGCGAAGACTTATCTAACACTGATTTGGTTCANATCGCCAAACTTNCTGAGCAG GCTGAACGGTATGATGATATGGCTGCAGCTATGANGCGTTATACCGAGGCTTCGGGGACTTTAGGGAACGAAGAACGGAA TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39368: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39368514762T14595SMEST0256Schistosoma mansoni, adult worm, Gloria Franco


Date: 7:16:12 on Sun 19 Nov 117.