EST 39377 is a singleton


Sequence

>39377 (1 EST) Length=346 ACCAAAATTATTATTTTTATTACGATTTTAAATTAAACATTTTTTTTTTGAGGGGGGGGGAGGGAAACCAAATCATATTG ACATTCAATGAAATAAAATGTATCTTTTTTTTTCTAAAAAAGGACCCAATTTTTTTAATAATAACCTTTTGTTATAGTTT CCATTCTTGAACAGGAATATGGAGGTCGTCCATCATGTGCAAATCTACCAAATAATTTATTATCATAATATACTCCAAAA TTGGATAAAGGTTTGAAAAATTCTATATTTCTAGCAAGTGGNATAATGCCAATAACANATGGTTANCTTGAATGTCCAGG GCGGACATTTTTTATCGGGGTATGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 39377: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39377514771T14604SMEST0265Schistosoma mansoni, adult worm, Gloria Franco


Date: 15:4:31 on Fri 24 Nov 117.