EST 39380 is a singleton


Sequence

>39380 (1 EST) Length=332 ATCACAAAATATTATATTAGGCTGTTAACCGCTTACAACGNAAAAGTAGATGTNATANTTAATACATAGTAGACATCCNA TNCNTGAAGCCATTTCGGTAAACCTCTTAAAACATACGTCCACCATATCCGTAAGTTTGTTTCAGTGCAGAAAGGNAAAT AGTGAGCCATCCGTCGCGGGTATTTTCCAAGTCATAAGCAGGANCATCTTTTTGTGTTAAAATAAGGNGTGTTCCACCTT CAAAAGCATTCATTTTCAACGTCAATGAGCTGTAGTGGTTCTCGGGCCAATCACGTTNTACGCCATCCTCATTTTGAATA CTTTTACCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39380: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39380514774T14607SMEST0268Schistosoma mansoni, adult worm, Gloria Franco


Date: 8:24:15 on Fri 24 Nov 117.