EST 393930 is a singleton


Sequence

>393930 (1 EST) Length=491 CGTGCCATTGGAGGTAACGAGCTGCGAGNATATGGNGGAGGANNGAGGACTAAAGCTAAGCGTGAAGATTATCGTCCATT AGAAACAAAGGAACAGTCTAAGAAAGGAATTGTCTTCANCAGGAAGTCAAAAAATAAAAAGAATAAAAAGGGACAGCATG TTACGAAAGAGGNCCCGGTTGNGTCTCCGTTTACAGGAGAACATGCAATNTNCGCTGCNCCGCTTTCTTTGGCTGTCTNA CGAATGGCTCCTCATGATGGNCTNCCNCTACCAGTTGTTGTAAGGCAGNGCATCGATTACATNAATGAAAAAGGNCTGTG TGTCGAAGGANTTCATCGGTTTTCTGCGCCAAAAGCANGTTTGGGATNAACTNGAGGAAGCAGTTNCTTCCGAGACATTC CATTGAGCTAAANGATGTACACGNNNCCTCGGGGGTTACTTGAAAANGTTTTCTGCGACANGCTTCCCGNGCNTTTCCTA ACTAATGANAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 393930: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939301081919H91489SWMFCA072SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:51:3 on Mon 20 Nov 117.