EST 393947 is a singleton


Sequence

>393947 (1 EST) Length=422 CTCGATTTGGATAANATATTATCGGACCCACATTCAGACTTGATGTTATCCGGTGGNAACTCCTCAGATGTTTATAATCC ATTTTTATCGAATGATGATCCTAATCTTGTCGAAAATAATTCGGAATCTAACGGGTCATACATATCGCCAGTGCCATATT TAGATGGTTCGAACTGNTTGNTGGATAGTTTATGTTTACAGNTAGACGCGCATGAGAATGTTGANGAGGAACATTCCTAT GCGTCCGTACGAACAGAATCGGCCACATCCTCGNTNTNTGGAGGAAGCAGNTCCATGGCTTCGTTTCTACAGAGTACAGA GNTTGATGTGCTTCAAGAAGCAAGTTAGAGAAATCCTTGATGATTGGAACAAGNGACAATNCTTTNCCCCCCACCACCAC AAGGGGGAAACTANNGCAGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 393947: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939471081936H91506SWMFCA090SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:59:12 on Wed 22 Nov 117.