EST 39395 is a singleton


Sequence

>39395 (1 EST) Length=186 CGGGCGAGATTTAGCAGCGTTCAAATTTTGCNGGCGAAACACGCAACTTTTGACACAGCATTGGAATCTTTCCATACAGC AGGGATTCAAACAATTACTNAACTCACGCTCNTTCGCAGCAGAGCACAATTCAGAGTCCAGCCATTAAACAACGTTTTAC CTTGNTTAATGGATCGTTGGGAACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39395: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39395514789T14622SMEST0283Schistosoma mansoni, adult worm, Gloria Franco


Date: 20:48:4 on Wed 22 Nov 117.