EST 393986 is a singleton


Sequence

>393986 (1 EST) Length=306 TAATGAAATAGCTTTCNTGTTATCGGTAGCCGTCAGTATCCCACTTATGCTGTTTCCAAGTCGAATTGCATTCTATAATC TCTTGAAATCGGATGCTTGTGAATACGCTATGCTACGTATGCCTCCGTTAATATNNGTTTCATNGACAGTATTTCTCTTG TCTTCGNGTTTATTAGCTGNAGTAATNGCCCCGAATGTTGAATTTATCCTCGGAATAACGGGNGCAACTATTGGCTGTCT AGTAACGATCANCANCCCATCGNTGTGATTCACATCAANATCTCGGGGCATCGAACAAATATCGNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 393986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939861081975H91545SWMFCA131SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:38:41 on Fri 17 Nov 117.