EST 39408 is a singleton


Sequence

>39408 (1 EST) Length=215 TACCGCACACTCGGCGATTCGGGCATCGTCAGCCTGATCGGTCTCGGTACGATGACGTGGGGCGAGCAGAATTCGGAGCG CGACGGACGAGCAGATCGACTACGCGATTGCGCAGGGCGTGACGCTGATCGATGCCGCGGAAATGTATCCGGTGCCGCCG AAGCCCGACACGCAGGGGCGCACCGAGCAATACATCGGGACCTGGCTCGCGCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39408: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39408514802T14635SMEST0296Schistosoma mansoni, adult worm, Gloria Franco


Date: 0:46:1 on Thu 23 Nov 117.