EST 39418 is a singleton


Sequence

>39418 (1 EST) Length=173 CAGTGAATTTAACAATGTGTATTTTCGATTTAATTGAGAATATTAATTGTGTGTTTGCATAGGTTTGATATTTTGTCTAG GTGTTCACACGGAGTTATCAAAGTGATCTGGATCAAACGTCAATCCACAGACTATTTTAACAATGTTAAATATTGAGGAA ATCGGGAAGATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 39418: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39418514812T14645SMEST0306Schistosoma mansoni, adult worm, Gloria Franco


Date: 4:34:30 on Wed 22 Nov 117.