EST 406135 is a singleton


Sequence

>406135 (1 EST) Length=177 GGATTCTGATAAATTGAGAAGACTGCATAAAAGATGGCAACAAACAGAAAGAGCTTTTCAAAAACAGCNCTGTATGAACA ATACTGCAACTGGATCGAGAAGCAGAAGATTACGATTCGATTGACTGGTCAACCCTANCTACGACTTGCAATGCTCATGA TATCGATGACGTGATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061351115040H97268KJ4SLB056T3JHU93SL-BmL4 (JHU)


Date: 22:10:22 on Sat 18 Nov 117.