EST 406137 is a singleton


Sequence

>406137 (1 EST) Length=102 ATAATTTGAAACACACTATATACCAATGTACAATTTGAGTGATAAGCTTGCAGAGTCTTGCTTAGGATAGCTAAGAACTT GTCGGATATATGATATACGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406137: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061371115042H97270KJ4SLB059T3JHU93SL-BmL4 (JHU)


Date: 21:13:12 on Fri 24 Nov 117.