EST 406138 is a singleton


Sequence

>406138 (1 EST) Length=142 ATATTACAAGAAAAAAAGCAACTAGAGGAGAACTTATTAGTCCACAAAAGGAGGAGAGCTCAATCCAATAAGAAGGAAGT CAGCATTTTTATAGATATATCCTAGATCCAGAGAGACAGTCCGTATAGAGATCATAGACTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406138: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061381115043H97271KJ4SLB060T3JHU93SL-BmL4 (JHU)


Date: 0:6:59 on Sun 19 Nov 117.