EST 406144 is a singleton


Sequence

>406144 (1 EST) Length=117 TTCTTGATCTGCTACTGTGATGCAATTTCTGTTGGTGCTGCTTTAACCAAAGATGGTAATATCCGGAATTGAGATGCTCT ATGTGACATTTCGACGTCGTACCTCGCTAGATCTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406144: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061441115049H97277KJ4SLB074T3JHU93SL-BmL4 (JHU)


Date: 20:44:28 on Tue 21 Nov 117.