EST 406146 is a singleton


Sequence

>406146 (1 EST) Length=117 GGCCTACATGCTATCGTCCTCCGTCCTCTACCTTCGTGTCACGCTCGAGAGCGAGAGCTCTCCTCCCATGATCGACTGTA CTGATCTCCATATCGAGATATATTCGATCAGTCTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061461115051H97279KJ4SLB076T3JHU93SL-BmL4 (JHU)


Date: 21:58:21 on Sat 18 Nov 117.