EST 406148 is a singleton


Sequence

>406148 (1 EST) Length=143 GGAAGAGAGAGCATACAACACGTATACAAGCGCATCGTCCTCAGTTCAGTAGTCGTCGAGCCTCGACTCAGATCTCATTC TACGATCCCGTTCAACGTATACTACTGACGAGCATAGAGCTTAGAGCTACTGATCCGAACGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406148: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061481115053H97281KJ4SLB078T3JHU93SL-BmL4 (JHU)


Date: 21:48:21 on Mon 20 Nov 117.