EST 406149 is a singleton


Sequence

>406149 (1 EST) Length=165 GGGCCTCAGGACAACGACATGACGGGAGAGATAGCCAGTCAGTCACCAGCCAAACACACGAGCCGGCAGACGGAATAGAT ATAACTGCACTCAGAGCTCTAATCAGCTACGATGATGAGTAGCAAGTCTCTAGCTCTAGCTCTGATAGCTCAGCATATTT TTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061491115054H97282KJ4SLB082T3JHU93SL-BmL4 (JHU)


Date: 0:17:5 on Thu 23 Nov 117.