EST 406150 is a singleton


Sequence

>406150 (1 EST) Length=185 AAAGAATNGTNATTAAGAGTTCTTNNTCTTATCAGTTACAAGTAACAAAAATCAAGAAATCTCAAGTAGACTAAGACTAT AACAAAAGAGTAATGTCTAACTATCTAAGTGCTGTCTCTACAAGACGACATGATGCTAGATAGACGAGCAGTAGTTAAGG ACTTGTACCTTCTACGAGATCACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406150: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061501115055H97283KJ4SLB097T3JHU93SL-BmL4 (JHU)


Date: 14:16:41 on Sat 18 Nov 117.