EST 406151 is a singleton


Sequence

>406151 (1 EST) Length=186 CCCAGTTTGTTCTNTTCTCTCTGTCGGTCTTCTACTCGATCTTCTCCTCAGTATTTTGGAACTTCCTTACAGTCAGAGAG AGATTGCAATTCNTTTCGAGTCGTCGTACAGCTCGATCGTTGATCGGCACAAGCGTCCTGTTCGTTCCGATCACGAGAGC CCGAGCTTGAGTACTCATTGGCCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406151: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061511115056H97284KJ4SLB100T3JHU93SL-BmL4 (JHU)


Date: 0:1:3 on Sun 19 Nov 117.