EST 406152 is a singleton


Sequence

>406152 (1 EST) Length=217 ATTACCCNAGTTNAGGGTTTTATATNGTGTGTGTGTGGCCTTCTTATTTNTTATCTACAATNGTGGAACAGATCGACCAC AGCCAGAAGATATGAGAGGAGTGTCTTNATCAGTTGGACTTATGTTGATATGGAAGATGCGATAAGTGGTTCAGCTTATC TGGAATCGTTATGGAGGTAGTATAGGCAGGTCTGCAAGATCTCTACAGTCGTCAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 406152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061521115057H97285KJ4SLB103T3JHU93SL-BmL4 (JHU)


Date: 0:15:15 on Fri 24 Nov 117.