EST 406153 is a singleton


Sequence

>406153 (1 EST) Length=221 TTGAGTCTTTNTAATTTACCCTAAGTTTTAGGTAACAGAGAAGAGTTGGTAGTATGTTTCAGCCGATATCAGTGGCGGTT ATTCAAAGACATCGTATTTCTGCGTCGATACGTGAATCCGAACATTTAGCAGAGAACTTTATATCTAGGTTACAGTATCT TCATGATTGTCATAGAAGTTGACATCAGCACATCTATGTAGACTTAGTGTTATGTGCGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406153: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061531115058H97286KJ4SLB107T3JHU93SL-BmL4 (JHU)


Date: 0:30:5 on Sat 25 Nov 117.