EST 406162 is a singleton


Sequence

>406162 (1 EST) Length=190 GAGCTNTTAATTAACCCNAGTGTAGCTACAGCTAATTAAGNNGGAGAGGAAGAGAACGGACGAGGACGAGCGAGGATTCA ACGGTGTCTTGGATTAGTTGAGATCAATGTGTTCTCATCATCAGTCTCGATCGTCAACGTAATCAGGCACGGATCGTGAT GTAGTCTGTCTATGTGATGATCTCAGCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 406162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061621115067H97256KJ4SLB027T3JHU93SL-BmL4 (JHU)


Date: 23:3:57 on Fri 24 Nov 117.