EST 406164 is a singleton


Sequence

>406164 (1 EST) Length=217 CTCTAGAGCTTTAATTACCCAAGTTTAGATATCGGTCGTTGATTTCAGTTGGGATAATTCCTAAATCTTTAAGTTGTTAC GATCGCTGAATTATATCGCTGAAGAGGGCTATCAGCTCTTCACGCACTGATGCTACACATTGATCATAGTCAGCTTATAC TCGTGTATGTACGTTCATCACGTGCCACATGCTAGAGAGTTGGAGAGTAATGCGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061641115069H97258KJ4SLB029T3JHU93SL-BmL4 (JHU)


Date: 0:48:57 on Thu 23 Nov 117.