EST 406166 is a singleton


Sequence

>406166 (1 EST) Length=137 GAGCTTATTACCCAGTTTAGACTGGCTAACTGAATCGAAACTCTTTCACGACTTCATTGTTGTTCTATTTCCATTAATTT TCAGATAAAAACTGGCATGAGAAAGACGCATTCTCTGAGACGCACACTAGAGATGNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406166: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061661115071H97260KJ4SLB033T3JHU93SL-BmL4 (JHU)


Date: 2:9:43 on Wed 22 Nov 117.