EST 406167 is a singleton


Sequence

>406167 (1 EST) Length=169 AGTACTTAATTACCTACAGTTTAGGTAACAATTCATCTTGAGTAATAGTTATAACTACGTATTNTATCCAGGCATTTCGT GAACCAATTCTTTAGTACTGTGATCAGTATAGTTCATGATGATCGATCATCGAGTATGCTCTAATCACACTATTCGCACT CATTCTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 406167: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061671115072H97261KJ4SLB039T3JHU93SL-BmL4 (JHU)


Date: 20:52:6 on Tue 21 Nov 117.