EST 406170 is a singleton


Sequence

>406170 (1 EST) Length=199 TTACCNAAAGTTTNAGATAAAAAAAATGTAACCCAAAAGGTATCGTGTGTCACGTTATATGTTGTAGAGAATTTCGAAAC TGGGTGAACCGTTGTCGACATTGTCGGCTTCAACTGGTACTTGACATAAGAACGTCTTCGAAGGATCGTCAGCATATATG ACGACTGACGTTATTGCAACTCTTAGAGTTGACACGGNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 406170: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061701115075H97264KJ4SLB043T3JHU93SL-BmL4 (JHU)


Date: 2:32:15 on Sat 25 Nov 117.