EST 406172 is a singleton


Sequence

>406172 (1 EST) Length=158 AATTTACCCAAAGTTTAAGGAAATAACTGTTAGAGGTATGCGAGAAACTTGCTGCTATGCAGTAAATCTCTTAGCATATA CCTAGCGATGCGTCATGATACTAGACTACCAAGTCTGTAGCAAACATATGATGACGACTGACAGCATATTAGAATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 406172: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061721115077H97266KJ4SLB051T3JHU93SL-BmL4 (JHU)


Date: 16:31:21 on Sat 18 Nov 117.