EST 406173 is a singleton


Sequence

>406173 (1 EST) Length=169 ATTAAAGTTTAGGGTTATTGTTAGTGAAGTATGAAAGATACTTATAGACTTTGGTGTTATTAGCTATATAGTTAAAGACA GGCGCAGAATCGGAGCTATGATGTAGGACAAATTAACATAGTCGAGTTACTACATTTACGGTAGCACTAAGACTCGTGTT TTATATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 406173: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061731115078H97267KJ4SLB054T3JHU93SL-BmL4 (JHU)


Date: 12:1:54 on Fri 24 Nov 117.