EST 406174 is a singleton


Sequence

>406174 (1 EST) Length=413 CAGTCACCACTTGAATATGATCCTGTTTTATGCCAGAAAACATCCTGCAAAGCAGTATTGATTGCTCTATGTACTGTCGA TTTTCGNAATAAAACGTGGATTTGCCCGNGTGGCAATCAGCGCANTTCGCTCATGGAACACGATTAAAGAAGACAATGCA CCATACATGAAAAAGGCGACAATCTTCTATGATGGTTTAGCTGCACGTGCAGTAAAAAACGGTCATGTAATTGATATTTA TTCATGCGCACTNGACCAAACAGGCTTGTATGAAATGCATGCTTGTNACAACACAACTGCAGGGAATGTAGTTATGGGCG ATAGNTTCAAGTCTTCGCTATTCAAACAAACGTACCAGTGTGTTTTCGAGAAAGATTGCAATGGCTTCCTGAAANTTGGG CTTTAATGCAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 406174: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061741118180H97295SW3ICA464SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:1:40 on Tue 21 Nov 117.